Brazilian Journal of Microbiology Brazilian Journal of Microbiology
Environmental Microbiology
Diversity and communities of culturable endophytic fungi from different tree peonies (geoherbs and non-geoherbs), and their biosynthetic potential analysis
Guodong Yanga,, , Peng Lia, Lifen Mengb, Keyi Xvc, Faming Donga, Yan Qiua, Lei Hea, Lin Lina
a Henan University of Science and Technology, College of Animal Science and Technology, Luoyang, Henan, People's Republic of China
b Henan University of Science and Technology, College of Chemical Engineering and Pharmaceutics, Luoyang, Henan, People's Republic of China
c Luoyang No.1 Senior High School, Class Nine, Grade Three, Luoyang, Henan, People's Republic of China
Received 14 March 2018, Accepted 14 June 2018
Abstract

To know more about the potential roles of endophytic fungi in the formation mechanism of Daodi medicinal material, diversity and communities of culturable endophytic fungi in three types of tree peonies were investigated. Endophytic fungi of three types of tree peonies were isolated and identified. The diversity was analyzed. Bayesian trees constructed by MrBayes 3.2.6 after phylogenetic analysis of the ITS sequences. The endophytic fungi potential for synthesis of natural products was assessed by means of detecting NRPS and PKS gene sequences. In total, 364 endophytic fungi isolates representing 26 genera were recovered from Paeonia ostii ‘Feng Dan’, Paeonia ostii ‘Luoyang Feng Dan’, and Paeonia suffruticosa ‘Luoyang Hong’. More culturable endophytic fungi appeared in P. suffruticosa ‘Luoyang Hong’ (206) compared with P. ostii ‘Feng Dan’ (60) and P. ostii ‘Luoyang Feng Dan’ (98). The fungal community of P. ostii ‘Feng Dan’ had the highest richness and diversity. PKSs and NRPS detection rates of endophytic fungi from P. ostii ‘Feng Dan’ are both the highest among the three types of tree peonies. Results indicate that endophytic fungus is an important factor of Daodi Cortex Moutan forming, and endophytic fungi in peony are related to genuineness of Cortex Moutan.

Keywords
Endophytic fungi, PKS, NRPS, Cortex Moutan, Daodi medicinal material
This article is only available in PDF
Introduction

Some traditional Chinese medicinal materials that are produced in specific geographic regions with designated natural conditions and ecological environment, and widely recognized as having better beneficial clinical therapeutic effects are called Daodi medicinal materials or geoherbs.1 As the essence of Chinese medicinal materials, Daodi medicinal materials have enjoyed a good reputation and have been playing an important role in treating disease and preserving health for thousands of years. From a biological point of view, heterogeneous individuals of the same species can be classified as either geoherbs or non-geoherbs, with their unique chemical constituents resulting from the interaction between minor polygenes and differential ecology.2 For instance, Paeonia suffruticosa Andrews, commonly called the tree peony, belongs to the Ranunculaceae family. The root bark of P. suffruticosa is called Cortex Moutan, which is a famous Chinese medicinal material and widely used in traditional Chinese medicine. Cortex Moutan produced from Paeonia ostii ‘Feng Dan’ in Tongling city, located in Anhui Province is considered a Daodi medicinal material (also called geoherbs). However, Cortex Moutan, which produced from P. ostii ‘Feng Dan’ that were transplanted in other regions of China or from other peony varieties, are called non-Daodi medicinal material (also called non-geoherbs). In recent years, researchers have studied the formation mechanism of Daodi Cortex Moutan from the perspectives of processing technique, environmental conditions, geochemistry, rhizosphere soil microorganism, trace elements, metabolism in animals, and obtained a series of important achievements. But the dominant factors of Daodi Cortex Moutan forming are not yet clear, the formation mechanism of Cortex Moutan needs further research.

Endophytic fungi are a group of diverse, fungal microorganisms that spend the whole or part of their life cycle in living plant tissues without causing any noticeable symptom of disease.3,4 It is noteworthy that endophytic fungi are ubiquitous in plant species that exist on the earth, and the endophytic colonization differs from tissues to tissues.5,6 They play important roles in the process of host plant growth and systematic evolution. Studies have shown that endophytic fungi have the capability to produce many kinds of identical or similar biologically active constituents as their host plants. These active constituents include antineoplastic paclitaxel,7 camptothecin,8 deoxypodophyllotoxin,9 the hypericin, etc.10 Polyketide synthetases (PKS) and non-ribosomal peptide synthetases (NRPS) are multifunctional enzymes catalyzing the biosynthesis of structurally diverse bioactive natural products. Polyketides and non-ribosomal peptides have been immensely concerned over the past decades, and numbers of various novel polyketide and non-ribosomal peptide compounds have been found from endophytic fungi. The presence of PKS and NRPS in fungi suggest their potential in producing related compounds and guides in producing related natural products.11–13 Endophytic fungi are widely distributed in healthy plant tissues. In addition, endophytic fungi can produce secondary metabolites that are also biosynthesized by their host plants. Is there an interrelationship between endophytic fungi and the formation of Daodi medicinal material? Is there a difference in diversity and communities of endophytic fungi between Daodi medicinal material and non-Daodi medicinal material?

In this study, with the aim to know more about the tree peony endophytic fungal diversity and find evidence for the potential roles of endophytic fungi in the formation mechanism of Daodi medicinal material, our objectives were therefore to (1) isolate and identify genetically and morphologically filamentous endophytic fungi of tree peonies from two different regions, (2) investigate the variation in the diversity and communities of the endophytic fungi population of tree peonies (geoherbs and non-geoherbs), (3) the potential of endophytic fungi in producing bioactive natural products was estimated based on the detection of PKS and non-ribosomal peptide synthetases (NRPS) genes.

Materials and methodsPlant sample collection

P. ostii ‘Feng Dan’ belongs to the section Moutan of the genus Paeonia and the family Paeoniaceae.14 Five-year-old P. ostii ‘Fen Dan’ plants, which were considered as the raw material of Daodi medicinal material, were collected from Phoenix Mountain Peony Garden, Tongling city, Anhui Province, China.

P. ostii ‘Feng Dan’ seedlings had grown in Anhui province for two years, and then the two-year-old seedlings have been transplanted in Luoyang city for three years. These five-year-old peony samples were collected from peony cultivation base of National Flower Park of China, Luoyang, Henan, China. In order to distinguish them from the above peony variety, we named them as P. ostii ‘Luoyang Feng Dan’. In essence, P. ostii ‘Luoyang Feng Dan’ and P. ostii ‘Feng Dan’ are the same peony varieties, but their growing regions are different. P. ostii in Tongling city and Luoyang city were named after P. ostii ‘Feng Dan’ and P. ostii ‘Luoyang Feng Dan’ respectively in the following narrative.

P. suffruticosa ‘Luoyang Hong’, a typical purplish red-flowered cultivar of Chinese traditional P. suffruticosa cultivars, is particularly appreciated by Chinese. In our study, P. suffruticosa ‘Luoyang Hong’ was also collected in peony cultivation base of National Flower Park of China, Luoyang city, Henan Province, China. The three types of tree peonies were collected in October 2014. A total of 30 individuals of each kind of tree peonies were collected. All plant materials were immediately brought to the laboratory, stored at 4°C in refrigerator and preprocessed within 24h. The tree peonies endophytic fungi were isolated according to the surface sterilization method described by Li Peng et al.15

Isolation and identification of endophytic fungi

The endophytic fungi were incubated on potato dextrose agar (PDA: 200g scrubbed and diced potatoes, 15g dextrose, 20g agar, and 1L distilled water) plates at 25°C in the dark until the colonies reached the rim of the dishes (9cm in diameter). All fungi isolates were examined periodically, and were classified into morphotypes based on their growth rates and morphological and microscopic characteristics (including shape of the mycelium, texture of the mycelium surface, production of spores (conidia, blastospores, sporangiospores or ascospores), color of the fungi, production of pigments and their diffusion into the medium). A total of 156 morphotypes were then identified based on the ITS sequence data. Mycelia of the fungal endophytes were ground completely with liquid nitrogen in a sterile mortar, and Genomic DNA extraction from all endophytic fungi was performed using a DN41 rapid DNA extraction kit (Aidlab Biotechnologies Co. Ltd., Beijing, PR China) following the manufacturer's recommendations for fungi. The internal transcribed spacer (ITS) region was amplified with universal primers ITS1(5′TCCGTTGGTGAAC CTGCGG3′) and ITS4(5′TCCTCCGGTTATTGATATGC3′). PCR mixture contained 12.5μL 2× Taq PCR Master Mix (Taq DNA Polymerase, Buffer, MgCl2 and deoxynucleotide triphosphates (dNTPs) were contained), 1μL DNA sample, 1μL of each primer and 9.5μL double distilled water. The PCR reaction conditions were as follows: initial pre-heating at 94°C for 3min, 30 cycles of 94°C for 30s, 58°C for 30s, 72°C for 30s, and a final extension at 72°C for 10min. After amplification, the PCR products were analyzed by electrophoresis on a 1.2% agarose gel stained with ethidium bromide (0.5ng/mL agarose) by stirring gently for 15min; the products were then visualized under UV light. The PCR products were separated on 1% (w/v) agarose gel and purified using a DNA Gel Exaction Kit (AXYGEN, Suzhou, PR China). The resulting DNA was sequenced directly using the same primers (Beijing Honor Tech Co. Ltd., Beijing, PR China).

The ITS sequence data of the endophytic fungi were submitted to the GenBank database. The ITS sequence was compared with that of the most closely-related fungal species (identity values higher than 95%) in the NCBI database (http://www.ncbi.nlm.nih.gov/) using the BLAST program, in consultation with observed colony and spore morphology to confirm the taxonomic status of the investigated fungal isolate. The sequence of Psilocybe cubensis was used as an outgroup. Bayesian trees constructed by PAUP 4.0b10 and MrBayes 3.2.6 after phylogenetic analysis of the ITS sequence data.

Screening of PKS and NRPS genes in tree peonies endophytic fungi

The highly conserved sequences of β-ketoacyl synthase (KS) domains are shared among all PKSs; thus, the KS domains are useful in screening for PKSs in fungi. Therefore, LC series primers (Table 1) were used to detect PKS genes in the fungal isolates.16 Similarly, the most conserved A domain can be used for PCR primer design to survey NRPSs gene diversity. Primers AUG003 and AUG007 (Table 1) were used for amplification of NRPS genes.17 The PCR reaction conditions were as follows: initial pre-heating at 94°C for 5min, 35 cycles of 95°C for 1min, 55°C for 1.5min, 72°C for 3min, and a final extension at 72°C for 10min. After amplification, the PCR products were inspected by electrophoresis on a 1.2% agarose gel stained with ethidium bromide (0.5ng/mL agarose) by stirring gently for 15min; the products were then visualized under UV light. Prior to cloning, PCR products were purified with DNA Gel Extraction Kit (San Prep SK8131, PR China). The sequences encoding the PKS or NRPS were cloned into a pUCm-T cloning vector (Sangon SK2211, PR China) and transformed into competent Escherichia coli cell (B529303 Ultra-Competent Cell Preps Kit, PR China) according to the manufacturer's protocol. The purified plasmid (using SanPrep Column Plasmid Mini-Preps Kit B518191, PR China) was sequenced.

Table 1.

Primer information of PKS and NRPS.

Primer pair  Primer sequence (5′–3′)  Amplification gene type 
AUG003  CCGGCACCACCGGNAARCCHAA  NRPS
AUG007  GCTGCATGGCGGTGATGSWRTSNCCBCC 
LC1-R  GAYCCIMGITTYTTYAAYATG  PKS
LC2C-F  GTICCIGTICCRTGCATYTC 
LC3-R  GCIGARCARATGGAYCCICA  PKS
LC5C-F  GTIGAIGTICRTGIGCYTC 
Date analysis

The colonization rate (CR) was calculated according to the method of Hata and Futai,18 CR=NCOL/Nt where NCOL is the number of segments colonized by each endophytic fungi; Nt is the total number of segments. The isolation rate (IR) was calculated as follow: IR=the number of EF isolated/the total number of fragments incubated.19 The Shannon diversity index (H′) and the Simpson's diversity index (D) were used to analyze the diversity of endophytic fungi and calculated as follows: Shannon diversity index, Simpson's diversity index, where k is the total number of fungal taxon, and Pi is the relative abundance of taxon i. Evenness values were calculated following Pielou's Evenness Index. Pielou's Evenness Index J=H/log (S), where H is the Shannon–Weaver diversity index and S is the number of species (species richness).20 Statistical analyses were performed using IBM SPSS Statistics Software (Version 20). The fungal phylotypes richness, the detection rates of PKSs and NRPS were subjected to ANOVA to test for significant differences between different types of tree peonies.

ResultsAbundance and diversity of endophytic fungi

A total of 364 endophytic fungal isolates were isolated from asymptomatic leaf, stem, and root segments of tree peonies plants following a standard isolation protocol. Results showed that P. suffruticosa ‘Luoyang Hong’ exhibited the highest number of endophytic fungi (206 isolates), followed by P. ostii ‘Luoyang Feng Dan’ (98 isolates), P. ostii ‘Feng Dan’ (60 isolates) (p<0.05) (Table 2). The colonization rate of P. suffruticosa ‘Luoyang Hong’ was the highest, flowed by P. ostii ‘Luoyang Feng Dan’, while P. ostii ‘Feng Dan’ is the lowest. A similar situation exists with the IR. The isolation rate of P. suffruticosa ‘Luoyang Hong’ was significant higher than that of P. ostii ‘Luoyang Feng Dan’ and P. ostii ‘Feng Dan’. The 364 isolated endophytic fungi were assigned to 156 morphospecies. All the morphotypes were identified based on the morphological characteristics and ITS sequence data (Table 3). Multiple alignment of the ITS sequence data was performed by Clustal W of MEGA ver. 6. MrModeltest 2.1 was used to choose the substitution model that best fit the data using the AIC criterion. The best model computed for Bayesian analysis was GTR+G. Bayesian analyses used one cold and three heated Monte Carlo Markov chains in two simultaneous runs. Bayesian analyses was computed with MrBayes 3.2.6 and carried out using 1.5×107 generations and a sample frequency of 100. The burn-in ratio was set at 0.25 (Fig. 1).

Table 2.

Colonization and isolation rate, species richness of tree peonies endophytic fungi.

Parameters  Paeonia ostii ‘Feng Dan’  Paeonia ostii ‘Luoyang Feng Dan’  Paeonia suffruticosa ‘Luoyang Hong’ 
No. of fragments incubated  78  78  78 
No. of fragments colonized  36  44  40 
Total number of isolates  60  98  206 
Colonization rate (CR)  0.4872  0.5641  0.8846 
Isolation rate (IR)  0.7692  1.2564  2.64 
Species richness (S17  10 
Shannon diversity index (H′)  2.5757  1.7730  1.3458 
Simpson's diversity index (D0.9006  0.7876  0.6125 
Pielou's Evenness Index (J0.9091  0.8069  0.5845 
Table 3.

Taxonomic affinities of tree peonies endophytic fungi.

Endophytic fungi  Species  Similarity %  Accession no.  Host planta 
A3G2  Peyronellaea  100%  KT343354.1  Fengdan 
A5J2-08  Schizophyllum  100%  KT343355.1  Fengdan 
A5J6F1  Pestalotiopsis  99%  KT343356.1  Fengdan 
A5J2F2  Cladosporium  99%  KT343357.1  Fengdan 
A5J8F3-2  Curvularia  100%  KT343358.1  Fengdan 
A5J10B1  Chaetomium  100%  KT375580.1  Fengdan 
A5J2F3  Seimatosporium  99%  KT375581.1  Fengdan 
A5J8F1  Nectriaceae sp.  99%  KT375582.1  Fengdan 
A5J6C1-2  Phomopsis  99%  KT375583.1  Fengdan 
A5J1A1  Phomopsis  99%  KT375584.1  Fengdan 
A5J6F3  Phomopsis  99%  KT375585.1  Fengdan 
A5G10D1  Penicillium  99%  KT375586.1  Fengdan 
A5J9F1-1-1  Phomopsis  99%  KT375587.1  Fengdan 
A5J10F1  Sordariomycetes  100%  KT375588.1  Fengdan 
A5J7F1-1  Nigrospora  99%  KT375589.1  Fengdan 
A5J2B1-1-2  Nigrospora  99%  KT375590.1  Fengdan 
A5J2B1-1  Nigrospora  99%  KT375591.1  Fengdan 
A5J6D1  Phomopsis  99%  KT375592.1  Fengdan 
A5J6C1-1-1  Nigrospora  99%  KT375593.1  Fengdan 
A5J7F2  Pestalotiopsis  99%  KT375594.1  Fengdan 
A5J3F1  Alternaria  99%  KT375595.1  Fengdan 
A5J2B1-2  Alternaria  99%  KT375596.1  Fengdan 
A3J1-01  Diaporthe  99%  KT375599.1  Fengdan 
A7G2-12  Fusarium  98%  KT375601.1  Fengdan 
A3J1-03  Ceratobasidium  99%  KT375600.1  Fengdan 
A5J2-06  Talaromyces  98%  KT375597.1  Fengdan 
A7J2-01  Fusarium  100%  KT375598.1  Fengdan 
J6F1  Alternaria  100%  KT375676.1  Luoyang Fengdan 
J1B1-2  Fusarium  99%  KT375677.1  Luoyang Fengdan 
J4D1  Paraconiothyrium  97%  KT375678.1  Luoyang Fengdan 
G1B1  Fusarium  99%  KT375679.1  Luoyang Fengdan 
J1C1–2  Phoma  99%  KT375680.1  Luoyang Fengdan 
J9E5  Alternaria  99%  KT375681.1  Luoyang Fengdan 
J2A1  Paraconiothyrium  99%  KT375682.1  Luoyang Fengdan 
G9A1  Fusarium  99%  KT375683.1  Luoyang Fengdan 
G8A1  Fusarium  100%  KT375684.1  Luoyang Fengdan 
J4F1–2  Fusarium  99%  KT375685.1  Luoyang Fengdan 
J1F1  Botryosphaeria  99%  KT375686.1  Luoyang Fengdan 
J4C1  Phoma  99%  KT375687.1  Luoyang Fengdan 
J9E1  Fusarium  99%  KT375688.1  Luoyang Fengdan 
J10C1  Botryosphaeria  99%  KT375689.1  Luoyang Fengdan 
J1A1–2  Paraconiothyrium  99%  KT375690.1  Luoyang Fengdan 
J4E1  Alternaria  99%  KT375691.1  Luoyang Fengdan 
J7A1–1  Phoma  99%  KT375692.1  Luoyang Fengdan 
G7D1  Fusarium  100%  KT375693.1  Luoyang Fengdan 
S3B1–2  Fusarium  100%  KT375694.1  Luoyang Fengdan 
G6D1  Fusarium  100%  KT375695.1  Luoyang Fengdan 
S1C1  Phoma  99%  KT375696.1  Luoyang Fengdan 
J13C1  Phoma  99%  KT375697.1  Luoyang Fengdan 
J7C1  Botryosphaeria  99%  KT375698.1  Luoyang Fengdan 
J1F  Botryosphaeria  99%  KT375699.1  Luoyang Fengdan 
J11A1–1  Alternaria  100%  KT375700.1  Luoyang Fengdan 
G4A1  Alternaria  100%  KT375701.1  Luoyang Fengdan 
S3C1–2  Alternaria  100%  KT375702.1  Luoyang Fengdan 
S3B1–3  Fusarium  99%  KT375703.1  Luoyang Fengdan 
J4C1–1  Phoma  99%  KT375704.1  Luoyang Fengdan 
J12C1  Phoma  99%  KT375705.1  Luoyang Fengdan 
J8D1  Alternaria  100%  KT375706.1  Luoyang Fengdan 
J1B1-1  Alternaria  99%  KT375724.1  Luoyang Fengdan 
J6E1  Phoma  95%  KT375708.1  Luoyang Fengdan 
J11B1  Phoma  99%  KT375709.1  Luoyang Fengdan 
G9C1  Fusarium  100%  KT375710.1  Luoyang Fengdan 
J12B1  Phoma  100%  KT375711.1  Luoyang Fengdan 
J7A1-2  Paraconiothyrium  99%  KT375712.1  Luoyang Fengdan 
G8C1  Fusarium  99%  KT375713.1  Luoyang Fengdan 
G5-3  Phialophora  95%  KT375714.1  Luoyang Fengdan 
J4C1-2  Phoma  99%  KT375715.1  Luoyang Fengdan 
J4F1  Fusarium  99%  KT375716.1  Luoyang Fengdan 
J6C1  Phoma  99%  KT375717.1  Luoyang Fengdan 
J6D1  Phoma  99%  KT375718.1  Luoyang Fengdan 
S3B1-1  Fusarium  99%  KT375719.1  Luoyang Fengdan 
G10B1  Fusarium  99%  KT375720.1  Luoyang Fengdan 
J7B1  Alternaria  100%  KT375721.1  Luoyang Fengdan 
FJ2D1  Alternaria  99%  KT375722.1  Luoyang Fengdan 
G3-5  Schizophyllum  99%  KT375723.1  Luoyang Fengdan 
J1B1-1-1  Alternaria  99%  KT375724.1  Luoyang Fengdan 
J3B1  Fusarium  99%  KT375725.1  Luoyang Fengdan 
G10A1-1  Ilyonectria  99%  KT375726.1  Luoyang Fengdan 
Y3-1  Chaetomium  99%  KT375727.1  Luoyang Fengdan 
G1-4  Schizophyllum  99%  KT375728.1  Luoyang Fengdan 
J1-2  Chaetomium  99%  KP994323.1  Luoyang Fengdan 
G1-1  Fusarium  99%  KT375729.1  Luoyang Fengdan 
LY2A1  Alternaria  99%  KT375602.1  Luoyang Hong 
LG6B1  Cephalosporium  95%  KT375603.1  Luoyang Hong 
LY3A1–2  Fusarium  95%  KT375604.1  Luoyang Hong 
LJ2G1  Alternaria  99%  KT375605.1  Luoyang Hong 
LY4E1–3  Alternaria  99%  KT375606.1  Luoyang Hong 
LJ14F1  Nigrospora  99%  KT375607.1  Luoyang Hong 
LG1C1  Pilidium  99%  KT375608.1  Luoyang Hong 
LJ11A1  Pestalotiopsi  99%  KT375609.1  Luoyang Hong 
LJ4B1  Fusarium  99%  KT375610.1  Luoyang Hong 
LJ12G1  Alternaria  99%  KT375611.1  Luoyang Hong 
LJ14E1  Fusarium  99%  KT375612.1  Luoyang Hong 
LG12B1  Arthopyreniaceae  98%  KT375652.1  Luoyang Hong 
LY1F1  Fusarium  97%  KT375613.1  Luoyang Hong 
LJ12B1  Alternaria  99%  KT375614.1  Luoyang Hong 
LJ9C1–2  Phomopsis  99%  KT375615.1  Luoyang Hong 
LY3B1–1  Fusarium  99%  KT375616.1  Luoyang Hong 
LJ7H1–2  Alternari  99%  KT375617.1  Luoyang Hong 
LJ13F1  Botryosphaeria  99%  KT375618.1  Luoyang Hong 
LJ11H1  Fusarium  99%  KT375619.1  Luoyang Hong 
LJ12J1–1  Fusarium  99%  KT375620.1  Luoyang Hong 
LY3D1–2  Fusarium  99%  KT375621.1  Luoyang Hong 
LJ4D1–1  Fusarium  99%  KT375622.1  Luoyang Hong 
LG2G1  Pilidium  100%  KT375623.1  Luoyang Hong 
LG5C1  Fusarium  99%  KT375624.1  Luoyang Hong 
LY6C1  Alternaria  100%  KT375625.1  Luoyang Hong 
LG13B1  Alternaria  99%  KT375626.1  Luoyang Hong 
LJ9B1  Alternaria  100%  KT375627.1  Luoyang Hong 
LA2A1  Alternaria  100%  KT375628.1  Luoyang Hong 
LY1B1  Alternaria  99%  KT375629.1  Luoyang Hong 
LY3C1  Alternaria  100%  KT375630.1  Luoyang Hong 
LY12F1  Pestalotiopsis  100%  KT375631.1  Luoyang Hong 
LY5A1  Pestalotiopsis  100%  KT375632.1  Luoyang Hong 
LY2C1  Alternaria  99%  KT375633.1  Luoyang Hong 
LY2E1  Alternaria  99%  KT375634.1  Luoyang Hong 
LJ11F1  Alternaria  99%  KT375635.1  Luoyang Hong 
LY4D1  Alternaria  99%  KT375636.1  Luoyang Hong 
LY1G1  Alternaria  99%  KT375637.1  Luoyang Hong 
LY4E1-1  Alternaria  99%  KT375638.1  Luoyang Hong 
LY3G1  Alternaria  99%  KT375639.1  Luoyang Hong 
LY7A1  Alternaria  99%  KT375640.1  Luoyang Hong 
LJ8C1  Alternaria  99%  KT375641.1  Luoyang Hong 
LG3E1  Fusarium  100%  KT375642.1  Luoyang Hong 
LJ12D1-2  Alternaria  100%  KT375643.1  Luoyang Hong 
LY6A1  Nigrospora  99%  KT375644.1  Luoyang Hong 
LJ5F1  Alternaria  99%  KT375645.1  Luoyang Hong 
LJ3D1-1  Fusarium  99%  KT375646.1  Luoyang Hong 
LJ5I1  Alternaria  99%  KT375647.1  Luoyang Hong 
LJ1D1  Alternaria  99%  KT375648.1  Luoyang Hong 
LJ14D1  Alternaria  99%  KT375649.1  Luoyang Hong 
LY4B1  Alternaria  100%  KT375650.1  Luoyang Hong 
LJ13A1  Alternaria  99%  KT375651.1  Luoyang Hong 
LY3E1  Alternaria  100%  KT375653.1  Luoyang Hong 
LJ3-5  Fusarium  99%  KT375654.1  Luoyang Hong 
LY1C1-1  Alternaria  100%  KT375655.1  Luoyang Hong 
LA3A1  Alternaria  99%  KT375656.1  Luoyang Hong 
LJ3-3  Fusarium  99%  KT375657.1  Luoyang Hong 
LY4E1-2  Alternaria  99%  KT375658.1  Luoyang Hong 
LJ14C1  Alternaria  100%  KT375659.1  Luoyang Hong 
LJ4F1  Fusarium  100%  KT375660.1  Luoyang Hong 
LJ9C1-1  Pestalotiopsis  99%  KT375661.1  Luoyang Hong 
LJ8D1  Alternaria  99%  KT375662.1  Luoyang Hong 
LY5C1  Pilidium  100%  KT375663.1  Luoyang Hong 
LG15C1  Fusarium  100%  KT375664.1  Luoyang Hong 
LY6B1  Alternaria  99%  KT375665.1  Luoyang Hong 
LY2B1  Alternaria  99%  KT375666.1  Luoyang Hong 
LY1A1  Fusarium  99%  KT375667.1  Luoyang Hong 
LD13D1  Alternaria  99%  KT375668.1  Luoyang Hong 
LJ6A1  Alternaria  100%  KT375669.1  Luoyang Hong 
LY1D1  Alternaria  99%  KT375670.1  Luoyang Hong 
LY4E  Alternaria  99%  KT375671.1  Luoyang Hong 
LY5B1-1  Alternaria  100%  KT375672.1  Luoyang Hong 
LA2B1  Alternaria  99%  KT375673.1  Luoyang Hong 
LG5B1  Fusarium  99%  KT375674.1  Luoyang Hong 
LJ1-1-1  Phyllosticta  99%  KT375675.1  Luoyang Hong 

ITS sequences based on BLAST search through GenBank.

a

Fengdan, Paeonia ostii ‘Feng Dan’; Luoyang Fengdan, Paeonia ostii ‘Luoyang Feng Dan’; Luoyang Hong, Paeonia suffruticosa ‘Luoyang Hong’.

Fig. 1.
(1.17MB).

Phylogenetic tree based on the ITS1, 5.8S and ITS2 region of rDNA obtained from endophytic fungi of three types of tree peonies. The tree was constructed via the Bayesian inference method. An individual of each taxon isolated was used in the construction of the clustering together with a reference sequence retrieved from GenBank (●). The fungus Psilocybe cubensis was used as outgroup for the construction of the tree.

To characterize the biodiversity of our samples, we calculated Species richness (S), Shannon diversity index (H′), Simpson's diversity index (D), and Pielou evenness index (J). The values obtained by these tests (17, 2.5757, 0.9006, and 0.9091, based on P. ostii ‘Feng Dan’; 9, 1.7730, 0.7876, and 0.8069, based on P. ostii ‘Luoyang Feng Dan’; 10, 1.3458, 0.6125, and 0.5845, based on P. suffruticosa ‘Luoyang Hong’, respectively) were shown in Table 2.

Community composition of endophytic fungi

In each of the three types of tree peonies, the composition of the endophytic fungi communities exhibited a high degree of variability. Among those detected, for P. ostii ‘Feng Dan’, a total of 17 different genera of endophytic fungi were isolated, Phomopsis was the dominant genus with relative frequency of 19.2%, followed by Nigrospora, Alternaria and Pestalotiopsis with relative frequencies of 15.4%, 7.7% and 7.7%, respectively; for P. ostii ‘Luoyang Feng Dan’, a total of 9 different genera of endophytic fungi were isolated, Fusarium was the dominant genus with relative frequency of 27.4%, followed by Phoma, Alternaria and Paraconiothyrium with relative frequencies of 23.5%, 19.6%, and 9.8%, respectively; for P. suffruticosa ‘Luoyang Hong’, a total of 10 different genera of endophytic fungi were isolated, Alternaria was the dominant genus with relative frequency of 55.7%, followed by Fusarium and Pestalotiopsis with relative frequencies of 25.7% and 5.8%, respectively (Fig. 2). A total of 26 different fungal genera were recovered from three types of tree peonies, of which, ten (38.5%) were exclusively isolated from P. ostii ‘Feng Dan’, four (15.4%) were only recovered from P. ostii ‘Luoyang Feng Dan’, four (15.4%) were merely obtained from P. suffruticosa ‘Luoyang Hong’, and eight (30.8%) were jointly found in the three types of tree peonies (Fig. 2). On the whole, the stems of tree peonies exhibited the highest number of endophytic fungi (221 isolates), followed by the leaves (85 isolates) and roots (58 isolates).

Fig. 2.
(0.19MB).

Pie charts show the relative abundance of the dominant culturable endophytic fungi phyla in three types of tree peonies. Venn's diagrams showing unique and shared genus in culturable endophytic fungi of P. ostii ‘Feng Dan’, P. ostii ‘Luoyang Feng Dan’ and P. suffruticosa ‘Luoyang Hong’ samples.

Identification of genes encoding bioactivity in tree peonies endophytic fungi

Degenerate PCRs were used to detect putative NRPS and PKS gene sequences originating from fungal endophytes in the DNA extracts. Amplification of fungal KS domains and A domains was confirmed via sequencing and BLASTX (translated) analysis. Based on the BLASTX analysis, a total of 69 endophytic fungi isolated from the three types of tree peonies were detected to contain fungal KS domain sequences (∼700bp). The amplified sequences possessed between 90% and 100% amino acid identity to known fungal PKSs. The detection rates of P. ostii ‘Feng Dan’ endophytic fungi, P. ostii ‘Luoyang Feng Dan’ endophytic fungi, P. suffruticosa ‘Luoyang Hong’ are 48.15%(13/27), 41.07%(23/56), and 44.59%(33/74) (p<0.05), respectively (Table 4). A total of 8 endophytic fungi isolated from the three types of tree peonies were detected to contain fungal A domains sequences (∼1500bp). The amplified sequences possessed between 64% and 75% amino acid identity to known fungal NRPS. The detection rates of P. ostii ‘Feng Dan’ endophytic fungi, P. ostii ‘Luoyang Feng Dan’ endophytic fungi, P. suffruticosa ‘Luoyang Hong’ endophytic fungi are 11.11% (3/27), 7.14% (4/56), and 1.35% (1/74) (p<0.05), respectively (Table 5).

Table 4.

PKS genes identified with degenerate PCR primers.

Endophtic fungi  Host planta  BLASTX match  Identity (%)  Accession no. 
A5J9F1-1-1  Fengdan  Dothiorella aegiceri putative PKS  99  ABS85549.1 
A7J201  Fengdan  Dipiodia seriata putative PKS  99  KKY20157.1 
A5J1A1  Fengdan  Dothiorella aegiceri putative PKS  99  ABS85549.1 
A5J3F1  Fengdan  Alternaria alternata PKS  100  AEH76763.1 
A5J7F2  Fengdan  Cladosporium phlei non-reducing PKS  99  AFP89389.1 
A5J6C1-2  Fengdan  Dothiorella aegiceri putative PKS  99  ABS85549.1 
A5J2B1-1  Fengdan  Alternaria alternata PKS  100  AEH76763.1 
A5J6D1  Fengdan  Dothiorella aegiceri putative PKS  98  ABS85549.1 
A5J2B1-1-2  Fengdan  Pestalotiopsis malicola PKS  94  AGT56219.1 
A5J10F1  Fengdan  Ascochyta anemones PKS  99  AGF50217.1 
A5G10D1  Fengdan  Talaromyces marneffei
ATCC 18224 conidial PKS 
98  XP 002147717.1 
A5J8F3-2  Fengdan  Bipolaris maydis PKS  99  AAR90272.1 
A5J6F3  Fengdan  Dothiorella aegiceri
putative PKS 
99  ABS85549.1 
J13C1  Luoyang Fengdan  Phoma sp. F41 PKS  98  AFH77855.1 
J6D1  Luoyang Fengdan  Ascochyta anemones PKS  99  AGF50217.1 
J4E1  Luoyang Fengdan  Alternaria alternata PKS  99  AEH76763.1 
J6F1  Luoyang Fengdan  Alternaria alternata PKS  99  AEH76763.1 
J12B1  Luoyang Fengdan  Ascochyta rabiei
1,3,6,8-tetrahydroxynaphthalene PKS 
99  ACS74449.1 
J9E5  Luoyang Fengdan  Alternaria alternata PKS  99  AEH76763.1 
J10C1  Luoyang Fengdan  Diplodia seriata putative PKS  98  KKY20157.1 
J4C1-2  Luoyang Fengdan  Ascochyta rabiei
1,3,6,8-tetrahydroxynaphthalene PKS 
98  ACS74449.1 
J2A1  Luoyang Fengdan  Bipolaris maydis PKS  97  AAR90272.1 
J6C1  Luoyang Fengdan  Ascochyta rabiei
1,3,6,8-tetrahydroxynaphthalene PKS 
99  ACS74449.1 
J4D1  Luoyang Fengdan  Bipolaris maydis PKS  97  AAR90272.1 
J1F1  Luoyang Fengdan  Diplodia seriata putative PKS  98  KKY20157.1 
J1A1-2  Luoyang Fengdan  Bipolaris maydis PKS  97  AAR90272.1 
J1B1-2  Luoyang Fengdan  Diplodia seriata putative PKS  99  KKY20157.1 
J4C1  Luoyang Fengdan  Ascochyta rabiei
1,3,6,8-tetrahydroxynaphthalene PKS 
99  ACS74449.1 
G5-3  Luoyang Fengdan  Marssonina brunneaf sp. ‘multigermtubi’ MB-m1 PKS  94  XP007295542.1 
J7C1  Luoyang Fengdan  Diplodia seriata putative PKS  99  KKY20157.1 
J11B1  Luoyang Fengdan  Ascochyta rabiei
1,3,6,8-tetrahydroxynaphthalene PKS 
98  ACS74449.1 
S3C1-2  Luoyang Fengdan  Alternaria alternata PKS  99  AEH76763.1 
J8D1  Luoyang Fengdan  Alternaria alternata PKS  100  AEH76763.1 
J4C1-1  Luoyang Fengdan  Ascochyta rabiei
1,3,6,8-tetrahydroxynaphthalene PKS 
99  ACS74449.1 
G4A1  Luoyang Fengdan  Alternaria alternata PKS  99  AEH76763.1 
J6E1  Luoyang Fengdan  Ascochyta rabiei
1,3,6,8-tetrahydroxynaphthalene PKS 
98  ACS74449.1 
LJ14F1  Luoyang Hong  Trichoderma sp. CBMAI 1018 PKS  93  ADY75766.1 
LJ12B1  Luoyang Hong  Conidial yellow piqment biosynthesis PKS  99  XP001933656.1 
LJ13F1  Luoyang Hong  Dipiodia seriata putative PKS  99  KKY20157.1 
LY4B1  Luoyang Hong  Alternaria sp. ALF3-2 PKS  100  AIR77264.1 
LY7A1  Luoyang Hong  Alternaria alternata
putative 6-MSA-type PKS 
93  BAG80613.1 
LJ9B1  Luoyang Hong  Conidial yellow piqment
biosynthesis PKS 
99  XP001933656.1 
LY1G1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY2A1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY4E1-1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LJ8D1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY4E1-3  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LJ12G1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY2E1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LA2A1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY1C1-1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY4D1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LJ12D1-2  Luoyang Hong  Humicolopsis
cephalosporioides PKS 
90  AGH27151.1 
LG1C1  Luoyang Hong  Humicolopsis
cephalosporioides PKS 
90  AGH27151.1 
LJ7H1-2  Luoyang Hong  Alternaria alternata PKS  100  AEH76763.1 
LA3A1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LJ13A1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY6C1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LJ2G1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LG2G1  Luoyang Hong  Humicolopsis cephalosporioides PKS  90  AGH27151.1 
LY5C1  Luoyang Hong  Humicolopsis cephalosporioides PKS  90  AGH27151.1 
LJ8C1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY3G1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LG12B1  Luoyang Hong  Dipiodia seriata putative PKS  98  KKY20157.1 
LJ9C1-2  Luoyang Hong  Dothiorella aegiceri putative PKS  99  ABS85549.1 
LY2C1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LY1B1  Luoyang Hong  Alternaria alternata PKS  99  AEH76763.1 
LJ11H1  Luoyang Hong  Dipiodia seriata putative PKS  98  KKY20157.1 
LY3C1  Luoyang Hong  Alternaria alternata PKS  100  AEH76763.1 
a

Fengdan, Paeonia ostii ‘Feng Dan’; Luoyang Fengdan, Paeonia ostii ‘Luoyang Feng Dan’; Luoyang Hong, Paeonia suffruticosa ‘Luoyang Hong’.

Table 5.

NRPS genes identified with degenerate PCR primers.

Endophtic fungi  Host planta  BLASTX match  Identity (%)  Accession no. 
LJ14F1  Luoyang Hong  Thielavia terrestris NRRL
8126 NRPS 
75  XM_003651133.1 
A5J6D1  Fengdan  Talaromyces stipitatus
ATCC 10500 NRPS 
70  XM_002483235.1 
A5J6F3  Fengdan  Metarhizium robertsii
ARSEF 23 NRPS Mrna 
72  XM_007827951.1 
A5J1A1  Fengdan  Myceliophthora thermophila
ATCC 42464 NRPS 
72  XM_003666434.1 
J1B1-2  Luoyang Fengdan  Thielavia terrestris NRRL
8126 NRPS 
64  XM_003651133.1 
J7C1  Luoyang Fengdan  Thielavia terrestris NRRL
8126 NRPS 
67  XM_003651133.1 
J1F1  Luoyang Fengdan  Thielavia terrestris NRRL
8126 NRPS 
75  XM_003651133.1 
G1B1  Luoyang Fengdan  Aspergillus niger CBS
513.88 NRPS 
69  XM 001392310.2 
a

Fengdan, Paeonia ostii ‘Feng Dan’; Luoyang Fengdan, Paeonia ostii ‘Luoyang Feng Dan’; Luoyang Hong, Paeonia suffruticosa ‘Luoyang Hong’.

Discussion

In this study, endophytic fungal isolated from three types of tree peonies were identified, and their communities’ composition were analyzed. The research results indicate that the biodiversity of fungal endophytes in the three types of tree peonies exhibited a high degree of difference. P. ostii ‘Feng Dan’ yielded low abundance strains and showed lower CR and IR, yet the Species richness (S), Shannon diversity index (H′), Simpson's diversity index (D) of P. ostii ‘Feng Dan’ were all higher than that of P. ostii ‘Luoyang Feng Dan’ and P. suffruticosa ‘Luoyang Hong’ (Table 2). There are altogether 26 different fungal genera recovered from three types of tree peonies, of which, 10 different fungal genera were exclusively isolated from P. ostii ‘Feng Dan’, 4 different fungal genera were only recovered from P. ostii ‘Luoyang Feng Dan’, 4 different fungal genera were merely obtained from P. suffruticosa ‘Luoyang Hong’, and 8 different fungal genera were jointly found in the three types of tree peonies. Compared with P. ostii ‘Luoyang Feng Dan’ and P. suffruticosa ‘Luoyang Hong’, P. ostii ‘Feng Dan’ which is the raw material of Daodi Cortex Moutan has more types of endophytic fungi. The diversity of P. ostii ‘Feng Dan’ endophytic fungi is the highest, flowed by that of P. ostii ‘Luoyang Feng Dan’, the diversity of endophytic fungi from the P. suffruticosa ‘Luoyang Hong’ is the lowest. In this study, P. ostii ‘Feng Dan’ and P. ostii ‘Luoyang Feng Dan’ are essentially the same variety of tree peonies, they just grow in the different geographical environment. But the diversity of P. ostii ‘Feng Dan’ endophytic fungi is significantly higher than that of P. ostii ‘Luoyang Feng Dan’ endophytic fungi. P. ostii ‘Luoyang Feng Dan’ and P. suffruticosa ‘Luoyang Hong’ are the different varieties of tree peonies, they grow in the same geographical environment. There is not much difference between the endophytic fungi diversity of P. ostii ‘Luoyang Feng Dan’ and P. suffruticosa ‘Luoyang Hong’. The results of the above studies suggest that, compared with the variety of tree peonies, geographical environment plays a more important role in affecting the diversity of tree peonies endophytic fungi.

From the perspective of endophytic fungi community composition, all the three types of tree peonies have different dominant genera. Ecological or environmental conditions, such as temperature, humidity, illumination, geographic location, and vegetation significantly affected the distribution pattern and population structure of the endophytic fungi.21Phomopsis is the dominant genus in the endophytic fungi community of P. ostii ‘Feng Dan’. That may have relevance to soil nutrition and geochemistry characteristic of Tongling city, Anhui Province, China. The study on the soil Cu, Cd, Pb and Zn at the copper-tailings reservoir of Tongling City showed that the Cu and Cd contents in soil were 4.36–14.43 and 3.67–3.86 times of the 2nd China national standard for soil environmental quality, respectively.22,23Phomopsis sp. is an ascomycete, that has attracted researcher's attention as a potential tool for heavy metal (copper, lead, zinc, etc.) contamination remediation. Research results indicate that after 24h contact time, up to 870mmol/g of lead, 390mmol/g of copper, 230mmol/g of cadmium, 150mmol/g of zinc and 110mmol/g of nickel ions are adsorbed into Phomopsis sp. biomaterial.24,25 In addition, endophytic fungi of Phomopsis sp. are excellent potential sources of novel, bioactive natural products for exploitation in medicine, agriculture, and industry.26,27Fusarium and Alternaria are the dominant genera in the endophytic fungi community of P. ostii ‘Luoyang Feng Dan’ and P. suffruticosa ‘Luoyang Hong’. They are the major plant pathogenic genera and the common genera in plant endophytic fungi community.28–31

Over centuries of treating disease and attempting to preserve health, ancestors of the Chinese people developed the traditional Chinese medicine (TCM). In addition, China also has abundant natural resources of medicinal materials, which are the material basis for the application of TCM theory in preventing and treating disease. As the essence of Chinese medicinal materials, Daodi medicinal material has been playing an important role in treating disease and preserving health for thousands of years.1 Cortex Moutan, which was produced from P. ostii ‘Feng Dan’ in Tongling city, located in Anhui Province, is considered as Daodi medicinal material. However, Cortex Moutan, which was produced from P. ostii ‘Feng Dan’ that were transplanted in other regions of China or from other peony varieties, is called non-Daodi medicinal material. To date, the dominant factor of Daodi Cortex Moutan forming is not yet clear. Bioactive components are the material basis for Daodi medicinal material to exert positive effect in preventing and treating disease. The most intrinsic difference between Daodi medicinal material and non-Daodi medicinal material is the difference in the types and amounts of bioactive components in medicinal plant. The NRPS and PKS are responsible for synthesizing many secondary metabolites that exhibit an important biological activity and may be valuable drugs.32 NRPS and PKS genomic analysis of the endophytic fungus reveals its potential for synthesis of natural products.32,33 In this study, NRPS and PKS gene sequences originating from fungal endophytes of three types of tree peonies were detected by Degenerate PCRs. As can be seen from the results (Tables 4 and 5), the PKSs and NRPS detection rates of endophytic fungi from P. ostii ‘Feng Dan’, which is the raw material of Daodi Cortex Moutan, are both the highest among the three types of tree peonies. The results of the above studies indicate that the endophytic fungi from P. ostii ‘Feng Dan’ have bigger potential for synthesis of natural products.

Conflicts of interest

The authors declare no conflicts of interest.

Acknowledgements

The authors wish to acknowledge the National Natural Science Foundation of China for financial support (project number 31302133).

References
1
Z.Z. Zhao,P. Guo,E. Brand
The formation of daodi medicinal materials
J Ethnopharmacol, 140 (2012), pp. 476-481 http://dx.doi.org/10.1016/j.jep.2012.01.048
2
L. Guo,S. Wang,J. Zhang
Effects of ecological factors on secondary metabolites and inorganic elements of Scutellaria baicalensis and analysis of geoherblism
Science China: Life Sci, 56 (2013), pp. 1047-1056
3
S. Kusari,S.P. Pandey,M. Spiteller
Untapped mutualistic paradigms linking host plant and endophytic fungal production of similar bioactive secondary metabolites
4
R. Tan,W. Zou
Endophytes: a rich source of functional metabolites
Nat Prod Rep, 18 (2001), pp. 448-459
5
G. Strobel,B. Daisy
Bioprospecting for microbial endophytes and their natural products
Microbiol Mol Biol Rev, 67 (2003), pp. 491-502
6
X. Sun,L.-D. Guo
Endophytic fungal diversity: review of traditional and molecular techniques
Mycology, 3 (2012), pp. 65-76
7
A. Stierle,G. Strobel,D. Stierle
Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew
Science, 260 (1993), pp. 214
8
P. Satish Chander,V. Vijeshwar,A. Touseef,Q. Ghulam Nabi,S. Michael
An endophytic fungus from Nothapodytes foetida that produces camptothecin
J Nat Prod, 68 (2005), pp. 1717-1719 http://dx.doi.org/10.1021/np0502802
9
S. Kusari,M. Lamshöft,M. Spiteller
Aspergillus fumigatus Fresenius, an endophytic fungus from Juniperus communis L. Horstmann as a novel source of the anticancer prodrug deoxypodophyllotoxin
J Appl Microbiol, 107 (2009), pp. 1019-1030 http://dx.doi.org/10.1111/j.1365-2672.2009.04285.x
10
S. Kusari,M. Lamshoft,S. Zühlke,M. Spiteller
An endophytic fungus from Hypericum perforatum that produces hypericin
J Nat Prod, 71 (2008), pp. 159-162 http://dx.doi.org/10.1021/np070669k
11
Y. Wang,B.L. Gao,X.X. Li,Z.B. Zhang,R.M. Yan,H.L. Yang,D. Zhu
Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis
Fungal Biol, 119 (2015), pp. 1032-1045 http://dx.doi.org/10.1016/j.funbio.2015.07.009
12
B.S. Evans,S.J. Robinson,N.L. Kelleher
Surveys of non-ribosomal peptide and polyketide assembly lines in fungi and prospects for their analysis in vitro and in vivo
Fungal Genet Biol, 48 (2011), pp. 49-61 http://dx.doi.org/10.1016/j.fgb.2010.06.012
13
W.C.S. Cho,K.I. Miller,C. Qing,D.M.Y. Sze,B.A. Neilan
Investigation of the biosynthetic potential of endophytes in traditional Chinese anticancer herbs
14
L.P. Peng,C.F. Cai,Y. Zhong
Genetic analyses reveal independent domestication origins of the emerging oil crop Paeonia ostii, a tree peony with a long-term cultivation history
15
P. Li,G.D. Yang,Y. Qiu,L. Lin,F. Dong
Paeonol produced by Chaetomium sp., an endophytic fungus isolated from Paeonia suffruticosa
Phytochem Lett, 13 (2015), pp. 334-342
16
K. Zhou,X. Zhang,F. Zhang,Z. Li
Phylogenetically diverse cultivable fungal community and polyketide synthase (PKS), non-ribosomal peptide synthase (NRPS) genes associated with the South China Sea Sponges
Microb Ecol, 62 (2011), pp. 644-654 http://dx.doi.org/10.1007/s00248-011-9859-y
17
V. Rédou,M. Navarri,L. Meslet-Cladière,G. Barbier,G. Burgaud,A.A. Brakhage
Species richness and adaptation of marine fungi from deep-subseafloor sediments
Appl Environ Microbiol, 81 (2015), pp. 3571-3583 http://dx.doi.org/10.1128/AEM.04064-14
18
K. Hata,K. Futai
Endophytic fungi associated with healthy pine needles and needles infested by the pine needle gall midge. Thecodiplosis japonensis
Can J Bot, 73 (1995), pp. 384-390
19
A. Saucedo-García,A.L. Anaya,F.J. Espinosa-García,M.C. González
Diversity and communities of foliar endophytic fungi from different agroecosystems of Coffea arabica L. in two regions of Veracruz, Mexico
20
J. Wang,S. Meier,J. Soininen
Regional and global elevational patterns of microbial species richness and evenness
Ecography, 39 (2016), pp. 1-10
21
M. Jia,L. Chen,H.-L. Xin
A friendly relationship between endophytic fungi and medicinal plants: a systematic review
Front Microbiol, 7 (2016), pp. 906 http://dx.doi.org/10.3389/fmicb.2016.00906
22
Z. Shen,Y. Wang,G. Wang,M. Yan,Z. Li,D. Liu
Heavy metals pollution of Paeonia ostii land at copper-tailings reservoir of Tongling city: a preliminary study
Ying Yong Sheng Tai Xue Bao, 16 (2005), pp. 673-677
23
Y. Wang,L. Zhang,Z. Shen,J. Li,D. Liu
Chemical forms of heavy metals in the soils and plants of copper tailings yard
Chin J Appl Ecol, 16 (2005), pp. 2418-2422
24
T. Sutjaritvorakul,A.J.S. Whalley,S. Roengsumran,P. Sihanonth
Solubilization and accumulation of insoluble zinc and lead compounds by fungi isolated from zinc mine
J Pure Appl Microbiol, 7 (2013), pp. 1043-1046
25
F. Saiano,M. Ciofalo,S.O. Cacciola,S. Ramirez
Metal ion adsorption by Phomopsis sp. biomaterial in laboratory experiments and real wastewater treatments
Water Res, 39 (2005), pp. 2273-2280 http://dx.doi.org/10.1016/j.watres.2005.04.022
26
K. Krohn,U. Farooq,H. Hussain
Novel highly substituted biaryl ethers, isolated from the endophytic fungus Phomopsis sp. from Ligustrum vulgare
Nat Prod Commun, 6 (2011), pp. 1907-1912
27
V.C. Verma,R.N. Kharwar,G.A. Strobel
Chemical and functional diversity of natural products from plant associated endophytic fungi
Nat Prod Commun, 4 (2009), pp. 1511-1532
28
S. Grube,J. Schonling,A. Prange
Evaluation of a triplex real-time PCR system to detect the plant-pathogenic molds Alternaria spp., Fusarium spp. and C. purpurea
J Microbiol Meth, 119 (2015), pp. 180-188
29
B.A. Summerell,J.F. Leslie,E.C.Y. Liew
Fusarium species associated with plants in Australia
Fungal Divers, 46 (2011), pp. 1-27
30
G. Tao,Z.Y. Liu,K.D. Hyde,X.Z. Liu,Z.N. Yu
Whole rDNA analysis reveals novel and endophytic fungi in Bletilla ochracea (Orchidaceae)
Fungal Divers, 33 (2008), pp. 101-122
31
J.G. Macia-Vicente,H.B. Jansson,S.K. Abdullah,E. Descals,J. Salinas,L.V. Lopez-Llorca
Fungal root endophytes from natural vegetation in Mediterranean environments with special reference to Fusarium spp
FEMS Microbiol Ecol, 64 (2008), pp. 90-105 http://dx.doi.org/10.1111/j.1574-6941.2007.00443.x
32
A.P. Graça,R. Calisto,O.M. Lage
Planctomycetes as novel source of bioactive molecules
Front Microbiol, 7 (2016), pp. 1241 http://dx.doi.org/10.3389/fmicb.2016.01241
33
X. Wang,X. Zhang,L. Liu
Genomic and transcriptomic analysis of the endophytic fungus Pestalotiopsis fici reveals its lifestyle and high potential for synthesis of natural products
Corresponding author at: 263, Avenue, Luoyang, Henan 471023, People's Republic of China. (Guodong Yang ygd2002@126.com)
Copyright © 2018. Sociedade Brasileira de Microbiologia
Cookies Policy
x
To improve our services and products, we use cookies (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here.